I have annotated 500 miRNA sequences that range between 16-40 from blastout.fa file (original) using mature miRNA database and stored them in a file (myresults). Now, I would like to find the occurrence/read count of each sequence present in myresults file from blastout.fa file (original). I knew how to find the occurrence of a single sequence, but I am facing difficulties in finding the read counts of all the sequences present in a file (myresults) from blastout.fa (original). For instance, ACCGUACGACGACCGUACGACG is annotated and present in myresults file, I am able to find the readcount of this sequence in blastout.fa file, but I am facing difficulties in finding the readcounts of all the 500 sequences present in the file. Kindly suggest.
Please provide examples of the file content and format, besides how are you counting. It is hard to know what you have