Error in miRDeep2

Question

[kuttibiotech2009]

Respected all,

I am working with miRNA data. Currently, I am facing the following issues in the genome.fa file. Please look at it and give your valuable comments to solve the error

Thanks

Error: problem with genome.fa Error in line 6.618: The sequence

TCAAATACTGAAAAATATTTCACAGCATTCTCATATTTGTGGTGAATTTTCAGAAGCTTR

contains characters others than [acgtnACGTN]

Please check your file for the following issues:

I. Sequences are allowed only to comprise characters [ACGTNacgtn]. II. Identifiers are not allowed to have withespaces.

Answer 1

[Jack Tierney]

Your sequence contains an R which isn't allowed.

[kuttibiotech2009]

Hello jack Tierney Thanks for your comment.. After replacing N with R it's working fine... I have posted another one question...please look at it and give your suggestions it will help me a lot