convert fasta/qual into fastq files via terminal linux?

Question

[Kárita]

How can I convert two files one fasta and one which into a single fastq file via linux terminal, if anyone can help me I'll be grateful!

[Pierre Lindenbaum]

two files one fasta and one which into

I don't understand.

Otherwise see fasta to fastq without quality scores

[Kárita]

sorry you cut the sentence, it was a .fasta file and a .qual

[Pierre Lindenbaum]

show us the header of each files.

[Kárita]

.fasta

>IBN2P8H01DK86M length=51 xy=1355_0556 region=1 run=R_2013_06_25_14_33_34_
GGGTGATGATCGCAACATCAGCTGTACATCGAGTAGACGTTCTGCGAACAC

.qual

>IBN2P8H01DK86M length=51 xy=1355_0556 region=1 run=R_2013_06_25_14_33_34_
40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 33 33 33 33 33 40 40 40 40 40 40 40 40 40 40 40 38 35 31 29 28 31 37 34 34 25 25 18 16 16

Answer 1

[GenoMax]

See: http://qiime.org/scripts/convert_fastaqual_fastq.html

[Kárita]

thank you, I will test it!

Answer 2

[Pierre Lindenbaum]

not tested, but it should be:

paste <(cat file1 | paste - - | sed 's/^/@/') \
          <(cat file2 | paste - - | cut -f2 )  |\
          awk -F '\t' '{printf("%s\n%s\n+\n%s\n",$1,$2,$3);}'

[GenoMax]

Pierre Lindenbaum Qual values will need to be encoded. They are numeric now.

[Pierre Lindenbaum]

ah yes, sorry , that's too much for a saturday ! :-¨P

[Kárita]

thanks anyway!

[Kárita]

does not recognize -F command