Entering edit mode
14 months ago
lonekaisar72
•
0
HI I am trying to do fastqc of one file but after running approximately 100 percent it is showing the below-listed error Please suggest what can be done. Thanks
Approx 100% complete for SRR18330177_2.fastq
It seems our guess for the total number of records wasn't very good. Sorry about that.
Still going at 105% complete for SRR18330177_2.fastq
Still going at 110% complete for SRR18330177_2.fastq
Still going at 115% complete for SRR18330177_2.fastq
Failed to process file SRR18330177_2.fastq
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'F:GAATAA7FFFFFFFFFFFFCCCTCGCCCACCATTCCCAAACTCFFFFF:F,F:F,,' didn't start with '+' at 72176579
at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:179)
at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:129)
at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:77)
at java.base/java.lang.Thread.run(Thread.java:829)
"everyone" is not a tag. Change it please.
what are the outputs of
and
Your file is corrupted. Better to get fresh copy of it.