Quantify miRNAs from whole transcriptome library (single end, TruSeq, 100bp)

Question

[w.denhollander]

I'm trying to wrap my head around the quantification of miRNAs from a (ribosome depleted) whole transcriptome library. Most of the approach I find here (and elsewhere) focus on specifically sequenced small RNAs.

Could anyone point me in the right direction? Preferably using Rsubread, but other approaches (Bowtie2 for example) are also fine.

EDIT: I should add that the alignment and quantification of gene transcripts seemed to work out fine using Rsubread, but I understand that as miRNAs are substantially smaller than my 100bp reads, I have to do some magic. I tried indexing and aligning against mature.fa from miRBase, but I end up with 0 aligned reads.

Answer 1

[GenoMax]

I have to do some magic

There is no magic. Find out what kit was used for the library prep. Normally there is a specific adapter involved that is directly ligated to miRNA' before library prep. This adapter is kit specific and will need to be trimmed before aligning the data (using ungapped alignments so use bowtie v.1.x). You will want to find out what kit was used.

[w.denhollander]

Thanks for the reply!

All the information I have is the following, but I guess that wouldn't be sufficient?

The libraries were prepared using out whole-transcriptome CORALL v2 kit with ribodepletion (RiboCop). The read length was SR100.

TruSeq adapters are used in the libraries: Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

[GenoMax]

Confirm this is the kit before proceeding.

https://www.lexogen.com/wp-content/uploads/2023/07/171UG394V0111_CORALL-RNA-Seq-V2-with-UDIs_2023-07-12.pdf on page 36 has instructions for data analysis.

This appears to be a total-RNA kit so you will have things other then miRNA (unless something special was done).

Answer 2

[markus.glass]

Usually, miRNAs are sequenced using specific smallRNA-library preparation methods (I think most, if not all of these methods include a size selection for small RNAs). I guess, the main problem with quantifying miRNAs from a totalRNA-seq is that miRNA abundance might be biased due to an excess of other RNA species getting most of the sequencing reads. Thus, I guess except for some very abundant miRNAs, e.g. miR-21 or let-7 (if you've sequenced human samples), results might not be very acurate.

Nevertheless, now, that you've got the (3'?) adapter sequences from the library prep kit, you can trim those off your reads using tools like Cutadapt or Trimmomatic, then align the sequenced reads to your reference genome/transcriptome using e.g. Bowtie and then quantify using e.g., Rsubread/FeatureCounts and the miRBase gff3 as annotation base.