How to make .fasta file

Question

[otieno43]

I have downloaded something that looks like a fasta file that from UTRdb 2.0 1: http://utrdb.cloud.ba.infn.it/utrdb/. Upon closer look, it is not recognized as a fasta file. I am wondering how to convert the file into fasta. I have attached the file in the link below. Some help please.1

Thanks for the help.

Answer 1

[Umer]

Seems like the file is fasta but has some comments at start of the file like

#genome-build: ASM210954v1
#genome-version: ASM210954v1
#genome-date: 2017-04
#genome-build-accession: GCA_002109545.1
#genebuild-last-updated: 2020-03
>|five_prime_utr|ENSAPOT00000006813|ENSAPOG00000008320|61446_61655_+_MVNR01001590.1
GTTTCAGGACAACGATGCGGAGAATGGCGATAAAATAACACACAAAACTTTGGAAACCCC
CAAAGACATCTACCCCATTCATGTTGTTCCAGAAAATAAAGAGAGGACACAGGGATCATG
TGCCCACTTTAAGGAGAGGAAAGACGTCACAAAGCAGGTCCGCTCCAAGTCCCCCACACT
GTTGGTCAACTTGGAGGAGGCCTTGGAAAG

you can try removing them by

grep -v ^"#" input-file.utrs > output-file.utrs/fasta

[GenoMax]

output-file.utrs/fasta

Did you mean to say output-file.utrs.fasta?

[Umer]

i meant about the extention. either .utrs or .fasta

[otieno43]

I think the output can still be either file.utrs.fasta or just file.fasta.

[otieno43]

Let me try get rid of them and see what happens.

[otieno43]

This worked very well, thank you.

Answer 2

[Mensur Dlakic]

Your file is a gzipped archive. You must first unpack it with gunzip:

gunzip Glossina_fuscipes.Yale_Gfus_2.54.utrs.gz

That will make a file Glossina_fuscipes.Yale_Gfus_2.54.utrs with your UTRs in FASTA format.

[otieno43]

Had done this before and have repeated again but it still does not come up as fasta file but just like any other normal file with fasta file features.