Obtain genome coordinates for a DNA sequence using ENSEMBL API

Question

[Ishan]

I can successfully use Ensembl BLAT to identify the coordinates in hg38 human genome e.g. for sequence: ACTCACCTCTTGCCAGTGAC

However I have many hundreds of sequences where I need to identify the coordinates and I wanted to use an API to do this. Is there anyway to get the genomic coordinates for short DNA segments such as above?

Answer 1

[GenoMax]

If you are using linux (and are not from a for-profit or industrial institution) you can set up gfServer/gfclient locally to do multiple blat searches.

https://genome.ucsc.edu/FAQ/FAQblat.html#blat3
https://genome.ucsc.edu/FAQ/FAQblat.html#blat11