Entering edit mode
6 weeks ago
Ishan
•
0
I can successfully use Ensembl BLAT to identify the coordinates in hg38 human genome e.g. for sequence: ACTCACCTCTTGCCAGTGAC
However I have many hundreds of sequences where I need to identify the coordinates and I wanted to use an API to do this. Is there anyway to get the genomic coordinates for short DNA segments such as above?