Hello! I'm trying to analyze some metagenomic samples that are a mixture of bacteria and fungi. I used the QIAseq 16S/ITS Screening Panel Kit for library prep, and now I'm looking for the sequence of the 16S and ITS primers from that kit and can't find anything. Does anyone else know where to find that information?
Thank you!
From Resources Tab --> Application Note found at --> https://www.qiagen.com/us/products/next-generation-sequencing/metagenomics/targeted-metagenomics/qiaseq-16s-its-region-panel
Sequences for the full-length primers targeting the 16S gene are as follows:
16S PCR Forward Primer
= 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (CCTACGGGNGGCWGCAG)
16S PCR Reverse Primer
= 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (GACTACHVGGGTATCTAATCC)
The underlined sequences (shown in paranthesis above) target the V3V4 region of the 16S rRNA gene.
Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
version 2.3.6
Hello! Any luck figuring this out? I am now facing the same situation.