Biostar

884 results • Page 3 of 18

Hello, I am getting the following error when trying to use trimmomatic. I cannot figure out what is wrong. I have reformatted my adapter fasta to be similar to theirs. I couldn't find any...Hello, I am getting the following error when trying to use trimmomatic. I cannot figure out what is wrong. I have reformatted my adapter fasta to be similar to theirs. I couldn't find any strange spaces in m…

QC trimmomatic

updated 6.2 years ago • bwee

Hi, I have Single End fastq file and it needs trimming. So, I use trimmomatic software for this purpose.based on trimmomatic tutorial I write below code for my .fastq file: java -jar /home/ubuntu...CIRI_v2.0.6/Trimmomatic-0.36/trimmomatic-0.36.jar SE -threads 2 -phred33 sra_data_SRR1427482.fastq SRR1427482 LEADING:20 TRAILING

software error RNA-Seq

updated 7.0 years ago • modarzi

I would like to know if I can pass a fastq file in trimmomatic, and then pass again its results. Also, how can I be sure that a fastq file that I downloaded from public sources...I would like to know if I can pass a fastq file in trimmomatic, and then pass again its results. Also, how can I be sure that a fastq file that I downloaded from public sources has...of reports (as for example GC content…

fastq trimmomatic quality

updated 3.5 years ago • Vitor1

I am fairly new to using bioinformatics software through ubuntu so bear with me. I am trying to run Trimmomatic to trim single end sequences. I installed it with conda/anaconda. I run this command java -jar /marshall/anaconda3...share/trimmomatic-0.39-2.jar SE -threads 6 /Illumina_DNA_Reads/AMT0102_48_S1_R1_001.fastq.gz /Illumina_DNA_Reads/output_new.fastq.gz...ILLUMINACLIP:/marsha…

trimmomatic-0.39 trimmomatic ILLUMINACLIP

updated 3.0 years ago • Barrington

I am using trimmomatic to improve the quality of my sequenced reads, I used the following code. java -jar $EBROOTTRIMMOMATIC/trimmomatic

Trimmomatic

updated 15 months ago • sainavyav22

Hi. I have a code that is working to process multiple **single-end** samples with trimmomatic, but I would like to adapt it such that I can run the code with **multiple paired-end** samples too, but I don't know how...work for me. Any help appreciated! My single-end code: for file in ./*R1_001.fastq.gz; do trimmomatic SE -threads 1 -trimlog $file_trim.log -phred33 $file "`basename $fi…

Trimmomatic

updated 2.3 years ago • ng

to improve the trimming procedure or this normal because of issues in the original row data ?? my trimmomatic command: java -jar ~/Desktop/Trimmomatic-0.36/trimmomatic-0.36.jar PE -phred33 SRR11771_1.fastq SRR11771_2.fastq

RNA-Seq next-gen genome sequencing alignment

updated 5.6 years ago • joe

I simply need to run Trimmomatic, but he doesn`t see input files. May be you know how to deal with it? #creating variables INPUT_DIR="path/folderinput...folderoutput" APPENDIX=".fastq.gz" APPENDIX1="_R1.fastq.gz" APPENDIX2="_R2.fastq.gz" TRIMMOMATIC="java -jar /home/path/trimmomatic-0.36.jar" #creating a loop for i in $INPUT_DIR/*$APPENDIX1 do …

Trimmomatic

updated 3.1 years ago • vvs.hazia

hi everybody I use trimmomatic softwre for trimming and Iget 4output paired files(forward and reverse) unpaired (forward and reverse) i didn

next-gen

updated 5.9 years ago • haddadfatiha62

I'm trying to trun trimmomatic on all of my fastq files at the same time, this is my command: trimmomatic SE Sample*merge.fastq.gz Sample*_trimmed.fastq.gz...Trimmomatic.java:85) I'm not sure what this means? If I run trimmomatic on my files individually it works, so why doesn't it work when I try to run them together? Thanks

fastq trimmomatic RNA-seq

updated 3.9 years ago • foxiw

in Snakemake. I want to create a workflow for Illumina data analysis. I'm currently programming trimmomatic rule and I'm facing to issue. This is the code: SAMPLES = ["1G_S15", "7G_S13"] rule trimmomatic_pe: input: adaptaters ="Illumina...output_reverse_unpaired_{sample}.fq.gz" conda: "condaf_file/base_env.yaml" log: "HHV8/logs/trimmomatic/{sample}.log" shell: "trimmomatic PE…

snakemake

updated 2.1 years ago • antoine.fauchois92

Hi, I am working on trimming adapter using Trimmomatic, but in my trials, I have been unable to get Trimmomatic to recognize and remove the adapter sequences. Some background

RNA-Seq

updated 6.1 years ago • qgww007

Hi all, I would like to perform quality control on multiple fastq folders using trimmomatic. I am going to work with thousands of SRA files that I will download from NCBI. However, each experiment may have...doesn't let me loop to trim all the SRA files in one loop. Do you have any suggestions to run the trimmomatic with all SRAs checking any adapter? This is the code: ``` cat listaSE …

trimmomatic

updated 2.8 years ago • pavelasquezv

issue by using the fastp tool as per Istvan's comment below. Im yet to find the root cause of the trimmomatic issue but will update once solved. Hi all, I have been using trimmomatic version 0.39 to trim some paired end reads...I have used the following command: for sample in "${arr[@]}" do echo "running trimmomatic for sample $sample" time java -jar ./Trimmomat…

trimmomatic Trimming quality control rna-seq

updated 3.2 years ago • hgal4248

Hello all, I have ran this script. ``` java -jar trimmomatic-0.35.jar \ PE \ -phred33 \ -trimlog /home/richardsonlab/AMMA_transcripts/trimmo30trimlog.txt \ /home/richardsonlab...Hello all, I have ran this script. ``` java -jar trimmomatic-0.35.jar \ PE \ -phred33 \ -trimlog /home/richardsonlab/AMMA_transcripts/trimmo30trimlog.txt \ /home/richardsonlab/AMMA_transcripts/R1V22_…

trimmomatic RNA-Seq QC

updated 13 months ago • nikelle.petrillo

I need help to write a for loop to run Trimmomatic tool for quality trimming of paired end fastq files. I need to write a for loop so that I can run an executable for...C3_R2.fastq T1_R1.fastq T1_R2.fastq T2_R1.fastq T2_R2.fastq T3_R1.fastq T3_R2.fastq To run trimmomatic for the paired reads corresponding to C1_R1.fastq and C1_R2.fastq, the following command works: java -jar ~/Trimmomatic…

ngs Assembly genome next-gen sequencing

updated 6.0 years ago • bioinformaticssrm2011

they use criteria with tool :- (>20% of the bases with a phred quality score < 10) using Trimmomatic v0.35 i was donig same with this code but the result is not same that on the paper.` fastq-dump --split-3 srr.sra --gzip...java -jar trimmomatic-0.35.jar PE -threads 8 -summary statsSummaryFile 1.fastq.gz 2.fastq.gz 1_paired.fq.gz 1_unpaired.fq.gz

trimmomatic

updated 4.1 years ago • CHINMAYA

Hi, I am trying to remove adapter sequences using trimmomatic and I am running into issues with the time it takes. I tried running an array job and it timed out. I am currently...Hi, I am trying to remove adapter sequences using trimmomatic and I am running into issues with the time it takes. I tried running an array job and it timed out. I am currently running...them one by one as per below …

memory trimmomatic

updated 9 months ago • jaganvibt

Dear all, I am trying to do trimmomatic of the files: CRR503927_f1.fastq and CRR503927_r2.fastq in jupyter-lab. I am getting the error as shown in the

trimmomatic

updated 9 months ago • dr.deepakkukkar

Hi, I'm a novice user of the trimmomatic program. My task in college is to create a script that will allow me to automate the trimming of 200 samples in...Hi, I'm a novice user of the trimmomatic program. My task in college is to create a script that will allow me to automate the trimming of 200 samples in turn

trimmomatic

updated 5.7 years ago • milord94

Hi All, I am a newcomer in bioinformatics. recently I use the trimmomatic to train myself. First, I install the trimmomatic by conda(it is really a great software), which means I can execute...by command line "trimmomatic PE -threads 4 -phred 33........(as the standard protocol)", it works but please below some errors happened: my question are...1. why cannot find the TruSeq3-PE.fa? I found the …

software error

updated 6.3 years ago • Decen

Hi. I'm analyzing RNA-seq data. My pipeline of RNA-seq was as below. (1) Trimmomatic exclude adapter sequences and low-quality bases from my fastq files. (2) Tophat2 mapped my reads to the reference...sequence (hg19). Trimmomatic didn't remove poly-A sequence from my fastq files. I would like to know how to trim poly-sequence before or after...trimming adapter sequences and low-quality base…

rna-seq

updated 5.7 years ago • Apprentice

R1_unpairedout.fastq R2_pairedout.fastq R2_unpairedout.fastq ILLUMINACLIP:/home/NSCLC/Trimmomatic-0.33/adapters/TruSeq3-PE-2.fa:2:30:10:1:true Multiple cores found: Using 16 threads Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT...92065 (0.21%) TrimmomaticPE: Completed successfully ``` NOW the real challenge: I am trying with Trimmomatic command for paired-end reads (PE) trims bases fro…

trimmomatic seq RNA

updated 2.9 years ago • David_emir

Multiplex Oligos for Illumina® (Dual Index Primers Set 1) for adaptors and primers. I want to use trimmomatic, it has adapter files for Truseq already, I wonder if anyone used trimmomatic for cleaning adapters from NEBnext

rna-seq

updated 5.2 years ago • eozcan

Hi, I want to use Trimmomatic 0.36 to trim ATAC-Seq adapter sequences. However, I am not sure which sequences I should use to trim our fastq files...you help me? May you share the correct sequence file with me for ATAC-Seq adapter trimming using Trimmomatic? Thank you very much. Trimmomatic commands & results I. using NexteraPE-PE.fa provided by Trimmomatic gary...gt; java -jar /U…

ATAC-Seq Trimmomatic Adapter Trimming

updated 6.2 years ago • Gary

29% of this sequence- GATCGGAAGAGCACACGTCTGAACTCCAGTCACACA (possible source- Trueseq adapter) I ran trimmomatic for both Trueseq2 and Trueseq3 but both don't seem to trim anything. Any suggestions? Thanks, Ritu

adapter-trimming next-gen-sequencing

updated 2.8 years ago • RT

I'm trying to write a code that works for multiple paired-end sequences for trimmomatic. I've tried a lot of different solutions found on this site, but nothing seems to work for my dataset. I have a code...end sequences. This is my code for multiple single-end: for file in ./*R1_001.fastq.gz; do trimmomatic SE -threads 1 -trimlog $file_trim.log -phred33 $file "`basename $file .fastq.gz`.t…

Trimmomatic

updated 2.3 years ago • john

I have a problem with Trimmomatic 0.36 that can't be solved with all the suggestions that I have found so far, since they are for PE mode (such as Trimmomatic...5 bases of every read (HEADCROP:5) in my fastq file (filename: Preprocessed_110.fastq.gz) using Trimmomatic. For which I run the following code: touch trimlog110.txt trimmomatic SE -trimlog trimlog110.txt Preprocessed_110.fastq.…

software-error RNA-Seq

updated 22 months ago • msimmer92

Hello. I tried useing Trimmomatic to trim RNA-seq reads. That is my first time useing it, and my operating system is windows. I'm trying to use the code...in the manual, but I'm unable to find solution to my problem. The script I use is: ``` java -jar trimmomatic-0.39.jar PE \ -phred33 \ C:/Users/yacov/Google_Drive/projects/file_fetch/SRR11813306_1.fastq \ C:/Users/yacov/Google_Drive...pr…

Linux windows Trimmomatic

updated 10 months ago • Gilad

I'd like to hear your opinion regarding optimal trimming tool for transcriptome-assembly (2x150bp Illumina NovaSeq). I generally use either fastp or Trimmomatic. I like the easy of use & speed of fastp. Also, the way fastp removes adapters I intuitively find very appealing. But the majority of users seems to stick to Trimmomatic. I also think that the selection of the tool itself is not…

trimming transcriptome

updated 4.1 years ago • Michael

I want to remove from my RNAseq data sequences that contain polyA tails. I want to do this via trimmomatic. Did I think about doing it by adding AAAA in the trimming adapter file? How have others done it

polyAAA trimming trimmomatic

updated 2.8 years ago • LDT

used for Illumina HiSeq4000? And if that adapter sequence is included in the list of the adapters of Trimmomatic? Thanks

next-gen sequencing SNP

updated 7.0 years ago • jav

Strand Specific RNA" can I just use TruSeq3 adapter files to trim? What about Nextera? I am using Trimmomatic. It was Illumina HiSeq 3000 which was used. Sorry if the question doesn't make sense, as I am new to this... Thank you

rna-seq sequencing assembly

updated 6.8 years ago • Moneeb Bajwa

Hello together, has anybody used Trimmomatic with the NEBNext Ultra II FS DNA Lib Prep Kit ([NEBNext Ultra II FS DNA][1]) together with Multiplex Oligos from NEB...e. g. [Multiplex Oligos for Illumina][2]) before? Do I need to adjust the reference adapter file of Trimmomatic? Since the adapters used by NEB are the same as of Illumina's TruSeq, I guess there is no adjustment needed. Am I right

Trimmomatic Adapters sequencing next-gen

updated 4.7 years ago • plicht

I have very similar error as many of you encountered before when trimming using Trimmomatic v 0.38. I am following the examples from the book "Bioinformatics A Practical Handbook of Next Generation Sequencing...the 2 input fastq files and Illumina adapter files are. java -jar /home/ivan/Desktop/BioTools/Trimmomatic/Trimmomatic-0.38/trimmomatic-0.38.jar PE s_6_1.fastq.gz s_6_2.fastq.gz s_6_…

Assembly

updated 6.4 years ago • stardust

I am running the command on cluster for trimming reads as provided below: module load trimmomatic trimmomatic PE -trimlog At -phred33 ../data/rnaSeq/ERR754059_1.fastq.gz ../data/rnaSeq/ERR754059_2.fastq.gz ERR754059_1.paired.fastq.gz...I am running the command on cluster for trimming reads as provided below: module load trimmomatic trimmomatic PE -trimlog At -phred33 .…

RNA-Seq software error

updated 8.8 years ago • mailme.ayan

I am running a script on paired end illumina data to run trimmomatic to remove adaptor sequences and low quality reads. The script is below: input_dir="/home/reads" # Define the output...the corresponding _2.fastq.gz file exists if [[ -f "$file2" ]]; then # Run the trimmomatic command trimmomatic PE "$file1" "$file2" \ -baseout "${output_…

fastqc fastq trimmomatic

updated 11 months ago • Wilber0x

I'm using Trimmomatic on gzipped paired files but the trailing low quality ends are not being trimmed?? I've done fastqc before and after...I'm using Trimmomatic on gzipped paired files but the trailing low quality ends are not being trimmed?? I've done fastqc before and after and there is no removal of the trailing end poor quality reads and there are a lot. Any suggestions on what I'm missing f…

updated 11.6 years ago • rob234king

Hello everyone, I am using Trimmomatic to trim RNA seq data.My question is why we set the minimum read length 36? if we decrease this value, how can it effect

RNA-Seq trimmomatic

updated 7.3 years ago • matiqau

I can't use the trimmomatic -trimlog output because it severely slows down the process and I just want to save the summary statistics. The...own output file in my bash script. #!/bin/bash for files in . do java -jar /path/to/trimmomatic-jar SE -phred33 ${files} ${files%%.fastq}_trimmed.fastq ILLUMINACLIP:/path/to/trimmomatic/adapters.fa:2:30:10 SLIDINGWINDOW

trimmomatic

updated 6.4 years ago • DNAngel

from an Illumina Hiseq and my fastqc analysis shows Illumina Universal Adapter contamination. I used trimmomatic to try and remove them. I used default settings I saw in the trimmomatic manual even though I don't really need quality...trimming (all high quality bases according to fastqc). java -jar $EBROOTTRIMMOMATIC/trimmomatic-0.36.jar PE R1_001.fastq.gz R2_002.fastq.gz R1_paired.fastq.gz…

RNA-Seq trimming Trimmomatic Adapters

updated 6.8 years ago • annsun89

Illumina Paired End PCR Primer 2 (97% over 36bp) ``` I have been told to use Trimmomatic, but I am struggling getting it to work. Could someone please guide as to how to only remove the above sequences...ILLUMINACLIP process and how to specify a custom list of adapters/primers to be trimmed. Also, will Trimmomatic work on 454 data? If not, what would be a suitable alternative? This was my prev…

next-gen sequencing RNA-Seq

updated 3.4 years ago • lewis.stevens07

Hello everyone, I am new to bioinformatic. I'm working on NGS data trimming using trimmomatic and have a problem dealing with this. Can anybody help me please? I used PE mode in trimmomatic like this; @naka-71...130 fastq % trimmomatic \ > PE -threads 2 -phred33 -trimlog log.txt \ > 20-026_S1_L001_R1_001.fastq.gz \ > 20-026_S1_L001_R2_001.fastq.gz...0.92%)…

software error trimmomatic

updated 4.3 years ago • leukippus0116

I'm using trimmomatic mainly to filter out adapters in the read through of my paired end illumina data. My command is as follows, and...expected results: java -jar trimmomatic-0.33.jar PE 01_R1.fastq 01_R2.fastq 01_R1-trimpair.fastq 01_R1-trimunpair.fastq 01_R2-trimpair.fastq...I can't work out how to direct how many nodes to use (the word node or core doesn't exist in the [trimmomatic manu…

trimmomatic fastq

updated 8.1 years ago • Daniel

Hello all, I am trying to run trimmomatic on paired fastq file. Can anyone please explain why it is unable to determine the input files? Fastq files SO_5492_LR_60A_BR_01_R1.fastq...SO_5492_LR_60A_BR_01_R2.fastq This is the command I used **Trimmomatic PE -threads 30 -basein SO_5492_LR_60A_BR_01_R1.fastq -baseout trim/SO_5492_LR_60A_BR_01.fq ILLUMINACLIP

NGS RnaSeq Trimmomatic Fastq

updated 3.5 years ago • Princy

Hi every body I am going to trim rna seq single end data(Illumina HiSeq 2000) by trimmomatics According to text: ***sets of samples were trimmed and filtered with Trimmomatic to remove adapters with up to...Hi every body I am going to trim rna seq single end data(Illumina HiSeq 2000) by trimmomatics According to text: ***sets of samples were trimmed and filtered with Trimmomatic to remove ada…

trimming rna-seq commands

updated 8.5 years ago • zh.khodadadi

Hello, I wanted to know if trimmomatic can only be run on GNU GPL v3 or it can also be run on windows environment? I am new to bioinformatics and I have no

sequencing

updated 5.3 years ago • pms

Hello, I hope someone can help me out with an error trying to run Trimmomatic from within a bash script This is the script: #!/bin/bash FORWARD=$1 REVERSE=$2 trimmomatic PE -threads 72 $FORWARD $REVERSE...unpaired_forward.fastq.gz paired_reverse.fastq.gz unpaired_reverse.fastq.gz ILLUMINACLIP:/opt/trimmomatic/adapters/NexteraPE-PE.fa:2:30:10 SLIDINGWINDOW:4:15 MINLEN:36 …

trimmomatic bash scipt

updated 4.9 years ago • diazjr.arturo

How do you decide to set the run to SE or PE on trimmomatic

next-gen RNA-seq

updated 2.4 years ago • didemdostt

Dear Community, :) I am using Trimmomatic for quality trimming and adapter removal from my RNA reads, before I continue with mapping (via GSNAP). Unfortunately...the reads that map to my overexpression plasmid, already before mapping. Is it possible to do so via Trimmomatic? I thought it should be possible, as Trimmomatic cuts adapter sequence as well. How would I have to adjust the command

rnaseq ngs overexpression trimmomatic gsnap

updated 3.9 years ago • ella

884 results • Page 3 of 18

Recent Votes

A: How do I process a FASTQ file in RStudio?

Comment: Problem with galaxy's Maxquant

Comment: Troubleshooting a REGENIE sex-stratified GWAS

Comment: Shall I regress out cell cycle in a CropSeq experiment

A: Get the Minor Allele Frequency for Specific Populations from NCBI dbSNP

Answer: Batch effects : ComBat or removebatcheffects (limma package) ?

Recent Locations • All