Biostar

9,151 results • Page 8 of 184

Hi, I have bam file and I would like to filter out spliced reads from the bam file. How can I achieve that directly on bam file. Kindly guide

RNA-Seq BAM spliced-reads

updated 8.8 years ago • EVR

Is there a tool I can use to input a BAM and do a collapsing based on sequence and positions and retaining the copy number of the unique sequence? (outputing again...BAM

bam collapse

updated 5.1 years ago • manekineko

Hi there! I am trying to edit values in a bam file, using Pysam, or any other interface. I want to change the base quality, and the read sequence of certain reads. I have...Hi there! I am trying to edit values in a bam file, using Pysam, or any other interface. I want to change the base quality, and the read sequence of certain reads. I have searched...a ton, but have not found any methods of edi…

genome alignment sequence sequencing

updated 7.6 years ago • zaidnab

I am new in WGS sequencing. I am working on the gatk HaplotypeCaller step. The bam file is required for calling variants. I have generated a few bam files upstream starting from bwa. I have sample1.bam, sample1.addRG.bam

gatk haplotypercaller bam

updated 6.3 years ago • Peter Chung

Hi, I'm having trouble sorting a bam file. I give the following command. samtools sort -m 40G -o file.bam file.sorted But I get lot of binary code displayed. I understand...it happens sometimes when you have insufficient memory. But I have given a memory of 40G and the bam file is only 250MB. Can anyone tell what I'm doing wrong? Thanks

bam samtools sort

updated 11.9 years ago • Jordan

I need to analyse a bam file with bamtools for C/C++. Can anyone help me reading the bases (A or C or G or T ) of the reads from a bam file? I also need to know...I need to analyse a bam file with bamtools for C/C++. Can anyone help me reading the bases (A or C or G or T ) of the reads from a bam file? I also need to know the quality of bases (base quality) and reads (mapping quality), but unfo…

read bam

updated 12.9 years ago • TwoFaces

By bam from outside, I mean the alignment made not by TopHat. Here in Using Cufflinks for RNA-Seq without Tophat/Bowtie. (2.4 years...Leszek said TopHat does special splice junction coding for Cufflinks, meaning to me that if the bam files are from something else, RUM in my case, then your Cufflinks run cannot identify the splice junctions. But at the same...time, nobody points out this prob…

rna-seq cufflinks

updated 11.3 years ago • thejustpark

I have 3 BAM files of the same specie, each of ~7GB, from three experimental runs. I merged the three BAM files to produce a single 22 GB bam...file, using samtools merge -r option. Then I sorted this merged bam file with samtools sort, and i got 11 GB merged bam. Is is possible to reduce the size of merged bam file by 50

genome sequence next-gen samtools sort

updated 9.7 years ago • shakeelbiochemist

Hello, I want to do variant calling of my multiple bam files. rule bcftools: input: ref="genome.fa", bam="/path/to/bam_list", output: outf ="chr.vcf" shell: "bcftools mpileup -f {input.ref...bam-list {input.bam} |" "bcftools call -vcO v {output.outf}" bam_list: bob.bam john.bam carl.bam .…

bcftools bam

updated 5.1 years ago • User000

installed splicegrapher but do not know which command to use to make splicegraph database. I have BAM file produced from TopHat

RNA-Seq splicegrapher

updated 6.1 years ago • qudrat

I have bam files and i need to convert them to .bedgraph format for my further analysis please help me in this issue

RNA-Seq ChIP-Seq Galaxy R genome

updated 6.9 years ago • praveenhcu131

I have made a subset of bam file and want to make consensus sequence from that. do you know how to convert a bam file into a fasta or fastq file with consensus

alignment

updated 5.1 years ago • Sara

Hi Can we sort BAM files according to the read name? As the normal sorting happens on the co-ordinates, can anyone tell how to sort a BAM file...to run HT-Seq count on paired end SAM files but receiving warnings for which I have to sort the BAM in read names and then create its SAM and then run HT-Seq

RNA-seq

updated 2.1 years ago • ivivek_ngs

Hi all! I have a little problem: I have 1 bam file (44gb ca) ant it contain the reads from 11 different sample. I have 2 txt file with sample name and a lot tab delimited...Hi all! I have a little problem: I have 1 bam file (44gb ca) ant it contain the reads from 11 different sample. I have 2 txt file with sample name and a lot tab delimited number...How can I split this unique BAM file into 11 d…

bam sample split split bam

updated 7.3 years ago • martyferr90

I have a bam file which appears to be corrupted but I can't understand where and why. The bam and index was generated using this script...lt;(bwa aln $ref $fq1) <(bwa aln $ref $fq2) $fq1 $fq2 \ | samtools view -Su - \ | samtools sort - bam/$bname && samtools index bam/${bname}.bam ``` I used the same script for other files which seem to be ok. Also, I repeated the alignme…

samtools bwa bam

updated 3.3 years ago • dariober

I am looking for a free (or relatively inexpensive) public server to host a few bam files that I would like to view in an online genome browser. I don't expect these bam files to be big so storage space is not...I expect these files to change. Finally, GitHub was an option but I could not figure out how, for a bam file, the browser can find the path for the index. Is there a public server that …

RNA-Seq alignment bam

updated 4.1 years ago • vkkodali

Hi everyone! This is my first time posting here. I have a very large BAM file (4.8GB) which I would like to process using the rMATS program to find splice variants. However, when I pass in the file...Hi everyone! This is my first time posting here. I have a very large BAM file (4.8GB) which I would like to process using the rMATS program to find splice variants. However, when I pass in the file…

rMATS processing BAM

updated 3.7 years ago • saipra003

iontorrent sequencer but I didn't put the reference genome for my sequence, So I've got an unaligned bam file Ubam. then I used the Torrent suite software to align my genome, I've got a new bam file which I want to convert it to fasta

genome alignment sequencing

updated 5.9 years ago • Maloki

Hello. I've been trying to use Rsamtools to input .bam files but when i use bam <- scanbam("myfile.bam") it keeps telling me my file doesn't exist, even though it does. I'm really new

bam rsamtools

updated 5.6 years ago • Nathalia Scheltinga

i have sorted *.bam file and i want to extract particular regions mapping i have .bed file chr2 179390716 179695529 chr3 89825161 90460254...chr8 144939497 144952632 samtools view -b -L .bed *.bam > output the output file have only NNNNNNNN, there's no reads. what is the problem? i already check if there position have

assembly sequencing genome

updated 5.7 years ago • 9521ljh

Hi, I am running Pindel version 0.2.4p, March 26 2012, on a set of BAM files. It chokes on them, printing out: No currentState.Reads for chr3 in file.bam (Note that the BAM files themselves were...not produced by BWA, but by another mapper). Since I could not use the BAM files I tried to generate the input to PINDEL by running sam2pindel on the corresponding set of SAM files, but this attempt…

pindel

updated 11.0 years ago • xenophiliuslovegood

Hello Biostarers. I am trying to compare BAM files for similarity. I am doing this to assess alignment from different pipelines. Is there a quick straightforward...Hello Biostarers. I am trying to compare BAM files for similarity. I am doing this to assess alignment from different pipelines. Is there a quick straightforward way

alignment BAM

updated 7.3 years ago • Hadeel

Hi, I downloaded a bam file from FTP server and have a bam.part file. What does bam.part mean? Thank you Regards

next-gen sequencing

updated 6.0 years ago • rse

Hai, I have a bam file and i need two fasta file, One is exactly mapped to reference and next one is not mapped to reference How to do with samtools

RNA-Seq

updated 5.9 years ago • bioz

hello I am using cmpbam to compare bam files.For this I have to extract read names from original bamfile by using this command. samtools view file1.bam K01...hello I am using cmpbam to compare bam files.For this I have to extract read names from original bamfile by using this command. samtools view file1.bam K01:2179...f 1 | sort | uniq > names.txt Can someone help me tha…

next-gen-sequencing

updated 21 months ago • himanimalhotra89

One can use CRAMtools to convert(compress) bam into cram. CRAMtools has options to allow for lossy and non-lossy compression (--lossless-quality-score and --lossy-quality...One can use CRAMtools to convert(compress) bam into cram. CRAMtools has options to allow for lossy and non-lossy compression (--lossless-quality-score and --lossy-quality-score-spec). Samtools is also capable of compressing …

samtools cram

updated 7.9 years ago • bjarki.sigurjons

I can remember where I read it but, I recall that I have read some where that if you have a bam sorted, you can unsorted it and some programs don't change the header (was samtools? picard?) so the SO:coordinate still is...I can remember where I read it but, I recall that I have read some where that if you have a bam sorted, you can unsorted it and some programs don't change the header (was samtoo…

next-gen sequencing bam

updated 13.8 years ago • Pablo Marin-Garcia

Dear Biostar users. I wanna convert bam to fastq. So I used "samtools bam2fq". This is my script. ``` fastq1=`echo $(basename ${input_file%%.gz.*})` fastq2=`echo ${fastq1/R1/R2}` samtools..._fastq | grep '^@.*/2$' -A 3 > $fastq2 ``` Is this right? --- And I wanna identify whether my bam file includes unmapped reads. so I run samtools flagstat. This is the result. In this resul…

fastq bam samtools

updated 2.0 years ago • oghzzang

Hi, Given a sorted bam file from standard 10x cell ranger output, i.e. from https://support.10xgenomics.com/single-cell-vdj/datasets/4.0.0/sc5p_v1p1_hs_PBMC_1k...I am wondering if it's possible to convert this scRNA-seq bam file to a bulk RNA-seq ("pseudo-bulk") bam file, e.g. combining reads across all cell barcodes in the bam file? I imagine there is

single cell samtools cell ranger RNA-Seq

updated 4.4 years ago • krc3004

Is there a rule of thumb for how large a BAI file will be relative to a BAM file? For example, if I have a BAM file that is 1GB and a supposed companion BAI file that is 1GB, would this be suspicious? What...if the BAM is 1GB and the BAI is 1MB? Thanks

bai bam

updated 3.0 years ago • joshua.theisen

of 4 bamfles.Now according to the protocol the next step is to run the cufflinks using the generated bam files , how can I run cufflinks from multiple bam files ,can anyone help me how do I do that ?Im not sure if its going to reduce

RNA-Seq

updated 8.2 years ago • krushnach80

absence analysis. After quality and adapter trimming, I have been able to generate alignment bam files from the reference genome for all isolates. One of the options for looking at gene presence absence is to do pangenome...I wanted to know how a single fasta file with the consensus sequence can be generated from sam/bam files so that it can be used in a pangenome analysis tool like ROARY. I am n…

sequence pangenome bam wgs

updated 6.5 years ago • ssj262

Hi Guys, I have a BAM file, and a big read list. What I want to do is to remove the reads in the read list from the BAM file. I can transform Bam to Sam...file and then use a Python script to remove unwanted reads. And then transform Sam to Bam again. But I am wondering if there is a more efficient way, which I mean faster, easier, and memory-efficient, to achieve this

RNA-Seq BAM samtools Sam

updated 9.2 years ago • Tao

Hi all, I'm wondering if I could check if a VCF file is derived from that BAM file. I know how to generate the VCF file from the BAM file through different pipelines but I'm just asking if there is/are...such a way to check/just to be sure especially if I have many VCF files and BAM files and I want to check which each VCF file belong to which BAM file. I appreciate your help in advance

VCF BAM

updated 5.6 years ago • LimMo

I have an aligned .bam file and a reference .fasta file. I'd like to convert the .bam and .fasta from an unpadded representation to a padded one (with...unpadded' as defined in the SAM spec). Are there tools that can do this either across the entire .bam and reference sequence, or alternatively just for reads that overlap a particular region? Ps. I know samtools had a pad2unpad

alignment SAM BAM

updated 3.1 years ago • bw.

I am getting BAM files with Bismark mapping with bowtie2. This gives you an unordered BAM file Thus, I am sorting the BAM file with the command...gt; samtools sort -O bam -T tmp_ -o Name_sorted.bam Unordered.bam The unordered bam file can have a 2,6Gb size, but the ordered one drops down to 1,2Gb...The same happens with all the bam files I am ordering. They are reduced to a half. Is that normal…

BAM samtools

updated 7.1 years ago • Antonio R. Franco

idea setting fragment option. There is no detailed explanation about length! So, I want to make BAM files converting to only 5' sequnece included. Is it possible to convert original BAM file to conserve BAM format? If not

BAM

updated 3.8 years ago • dahun73

sequenced (WES, single end protocol) and aligned (BWA aln) the same DNA sample twice obtaining 2 BAM files. I decided to merge these 2 BAMs into a single one. I used **MergeSamFiles** (BAM as inputs) from **Picard**. Thus, when I inspected...the merged bam file using `samtools view -H merged.BAM` it returns the message: [bam_header_read] EOF marker is absent. The input is probably...truncate…

genome sequence-alignment next-gen-sequencing

updated 2.6 years ago • Nicola Casiraghi

When I split BAM file by chromosome and then Cufflinks by chromosome-wise takes very less time compared to Cufflinks on whole BAM file

RNA-Seq alignment

updated 7.5 years ago • qudrat

Dear Biostars I am aware of samtools splitting of bam file based on chromosome. But is there any way I can divide a single chromosome bam file into halves or quarters ? Thanx in

bam split

updated 11.2 years ago • biorepine

Hello, I want to realize an in-silico dilution of a bam file into another one. I have 2 bam file (bam1 , bam2), I want to create a bam file (bam3) with 10% of bam1 and 90% bam2 at each sequenced...position. How can I do it ? the samtools view -s commande will take a fraction of a bam file, but since we don't guaranty the same depth coverage at a same position, we cannot guaranty the final fract…

bam alignment ngs

updated 7.5 years ago • Chadi Saad

I have three bam files, each bam file contains data from a sequencing lane. These three lanes represent the whole exome sequence of a single...patient. If I had not known that these three bam files belong to the same sequencing run, is there a way to figure out that these files are from the same study and from different...of these files. How would I figure out that the third one is missing? Ho…

bam next-gen sequencing

updated 8.8 years ago • Biomed

I have 2 BAMs of the some reads, but mapped to different genome. I extracted MAPQ from both, and get some index which correspond to reads...that have the same MAPQ in both BAMs (using R). Then I can export those index in txt format. Now how do I use the index found, for example, 2,3,4,5,8,9, to subset one of the...BAM file? The real problem is a bit more complex, as there are more than 2 BA…

BAM

updated 2.9 years ago • wt215

but I really have this problem. I have an aligned.bam file for a sample. I want to separate the bam file: 1) above a certain coverage 2) and bam file not in that coverage range. **I have selected the aligned reads above a certain...bed file > reads in this bed region i.e selected.bam. Now, **I want to get the portion of the bam file that is not in the selected.bam. So, basically its a co…

bam alignment samtools merge bedtools

updated 8.5 years ago • kirannbishwa01

I am doing the mapping of small RNA with maq . is there any option in maq to give me the output in BAM or SAM file? Thanks Sara

bam

updated 6.1 years ago • Sara

Hiii, I want to know the command line to convert BCF to BAM file on terminal (Linux). Kindly help me out. Thanks in advance

BCF to BAM Linux Ubuntu terminal Command line

updated 4.9 years ago • taniamahmood38

instance, ACCGUACGACGACCGUACGACG is annotated and present in myresults file, I am able to find the readcount of this sequence in blastout.fa file, but I am facing difficulties in finding the readcounts of all the 500 sequences

NGS blastn miRBase miRNA readcount

updated 2.3 years ago • khq5801

Hello I've created an alignment (SAM and subsequently BAM file) using samtools. However, when I'm trying to create an index out of the BAM file I get the following message: ``` $ samtools index

ChIP-Seq RNA-Seq

updated 2.4 years ago • Constantine

hello there, When I was trying to open a bam file on JBrowse, it kept showing 'unable to fetch'. I checked several times to ensure my bam file and bai file in correct position

RNA-Seq

updated 6.5 years ago • sw

I'm having a problem visualizing a BAM file with IGV. The file was generated with bowtie2 + samtools and can be viewed normally with BamView. IGV, however, doesn...I'm having a problem visualizing a BAM file with IGV. The file was generated with bowtie2 + samtools and can be viewed normally with BamView. IGV, however, doesn&#39...with IGV as the one I used for alignment. I als…

IGV bam alignment

updated 9.2 years ago • novice

9,151 results • Page 8 of 184

Recent Votes

A: Duplicated Reads In Rna-Seq Experiment

Duplicated Reads In Rna-Seq Experiment

Answer: making psam file for plink2

A: Should We Remove Duplicated Reads In Rna-Seq ?

Should We Remove Duplicated Reads In Rna-Seq ?

Comment: nanopore variant calling

Recent Locations • All