Biostar

66,121 results • Page 1 of 1323

Hello, I want to analyze single-cell RNA seq data that I took from a paper. The paper mentioned it has 8000 single cells and the library was made using cellranger...software 2.1.0. The data submission was done on NCBI in a total of 22 fastq files. When I took the fastq files and aligned it using STAR, I got 22 bam files which showed it has only 22 cells in it. It took...one fastq file as one ce…

RNA-Seq sequencing

updated 4.6 years ago • sidrah.maryam

Hi ! I did scRNAseq (10XChromium) of cancer cells and now I am looking for a simple way to split my FASTQ Files into celll specific FASTQ Files. Alternativley split my BAM...File into cell specific BAM Files - because I need one FASTQ (BAM) File per cell in order to do perform variant calling on the single...cell level. My goal is to obtain one single VCF file per cell. Is there a build-in funct…

RNA-Seq Cell Ranger Split Demultiplex BAM

updated 5.9 years ago • niklas.lang

Hello everyone, I have a sample of scRNA seq data (A.Thaliana) generated by 10X Genomics. The data is composed of R1 (cell barcodes and UMIs) and R2 (actual...reads) in FASTQ format. The sample has around ~7000 cells I ran the data through STAR solo to map them to the genome. The results are a BAM...file (mapped reads) and count matrix files. I need to run the mapped reads through some sort of…

10xgenomics RNAseq scRNA CB

updated 2.9 years ago • MYousry

Hello I greatly thank you to all of you in this website. I downloaded four of samples from PRJNA606815( https://www.ncbi.nlm.nih.gov/Traces/study/?acc=SRP249907&o=acc_s%3Aa ), using fasterq-dump. The...data are single-cell rna seq with 3' chemistry 10x genomics but I have one fastq file per sample. I expected some fastq files per sample but failed

single-cell scRNA-seq

updated 2.1 years ago • 기석

Hi all - I working with a dataset of fastq files generated from standard 10x sc-RNA seq where each fastq file has a pool of 2-3 different samples and ~5-10k cells. What...I would like to do is demultiplex the original fastq files into files that only contain 1 sample each. The layout of the reads is: I1: Pool barcode (8bp) R1: Cell barcode (10bp) + UMI...16bp) R2: Template (100bp) …

RNA-Seq sequence assembly

updated 4.5 years ago • bds1217

I am working with fastq files from a single-cell RNA (seq MARS Seq) published on the GEO website [GEO: GSE98969][1]. My first goal is to get an expression...matrix for each sample , i.e. a matrix U with n rows and m columns, where rows represent genes and columns represent cells. Entry Uij contains the...number of UMIs from gene i that were found in cell j. The problem is that each fastq file…

RNA-Seq alignment single-cell scRNA-seq

updated 6.3 years ago • Eldad Shulman

I'm bit new to cell ranger. I have tried using public datasets and download raw fastq files in SRA run selector ( by copy-pasting experiment...in European nucleotide archive). They have names like SRRXXXXXXX.fastq.gz. I tried to follow the cell ranger naming format for the same but am struck at the part on how to name the **sample**, **lane name** and the **read type**. Where can

cell genomics count ranger fastq 10x

updated 3.8 years ago • Meghamsh

I have `bcl` files from `10X genomics` and trying to `demultiplex` them and `generate fastq` files. to do so, I m using `cellranger mkfastq` and once...I have `fastq` files I will use `cellranger multi`. for the `cellranger mkfastq` command I need to specify `--samplesheet` or `--csv` file. according...to make a file almost like this since I also have multiple library types. but in our case…

scRNAseq

updated 2.0 years ago • Sara

Hi I am trying to access Coriell fatsq data for certain samples to generate vcf files. I was able to access and download a few from the [IGSR][1], and [1000genomes][2] portals with the ftp links...but some are not there, for example I cannot find: **NA17204** fastq/vcf files. Does anyone know where I may be able to access the Fastq or vcf files for the Coriell sample above or any other

Coriell

updated 2.2 years ago • not_richard

I am looking for single cell RNA SEQ Fastq files (paired end) that were generated for specific cell cycle phases. For example: - `Control_replicate1_R1_G1.fastq.gz

Cell-Cycle scRNA-Seq

updated 16 months ago • halimaakhter014

I have run cellranger on multiple fastq files that belong to different days and now I have output that can be read by Seurat but I need to know which time point...every cell belongs to. To my knowledge none of the files in the outs directory of cellranger contain that information. Is there a way...I can find out which fastq file every cell belongs to

scrnaseq cellranger fastq sequencing seurat

updated 2.6 years ago • Researcher

I have a very Old Fastq file that looks as- @ILLUMINA-DB1410_0001:1:1:1092:14610#0/1 CTAAATAAGNCCTTTCCCCACCTGTTTGATTCTGTTTCCT +ILLUMINA-DB1410_0001...1:1:1092:7332#0/1 bbbbbbbbbB^]^]_XUZ[WGOOOO`^^]^aaaaa_`aWa Now I want to find out the sample as I have bar codes like s_5_CGTACG_sequence.txt s_5_GAGTGG_sequence.txt s_5_ACTGAT_sequence.txt Is there...any way that I can find out…

Fastq

updated 8.2 years ago • joerodger2017

Hi, From what I understand, for smart-seq2 sequencing files there are multiple fastq files per sample with one single/pair per cell. However, in NCBI GEO I noticed usually there are...only a single pair of fastq files per sample like this one https://trace.ncbi.nlm.nih.gov/Traces/index.html?view=run_browser&acc=SRR6155048...view=run_browser&acc=SRR11548680&display=data-ac…

smart-seq geo scRNA-seq ncbi

updated 2.1 years ago • malonzm1

I used two lanes on a flow cell for the same library. I have the fastq files now, and want to merge the data together for each duplicate sample. At what point

ChIP-Seq fastq merge two lanes

updated 8.1 years ago • addilynn.beach

I have received 2448 separate fastq files generated by sequencing 48 samples on a MinION. How do I know which files belong to the individual samples

fastq

updated 2.8 years ago • kiapriscilla

Hello, I have a question regarding merging FASTQ files from the same sample but different sequencing runs. We generated cDNA libraries using the 10X v3 protocol but...t sure they had worked so initially sequenced only a small fraction of the library (10,000 reads/cell) using a NovaSeq. Once this data came back, it was analysed by generating count matrix and using Seurat we confirmed t…

Merging FASTQ cellranger scRNAseq 10X

updated 3.4 years ago • adellegreene

Hello everyone, I am hoping you could help me with a problem to deal with single fastq file. I am trying to download the fastq file for study GSM5467406. Although this is a paired end, but only one fastq file...available. I am wonder what should I do about this one. Since I hope I could re-run the cell ranger process. Because I use different version of cell ranger with this study

fastq

updated 2.6 years ago • Andy

Hi, I have a set of FASTQ files that I want to align to the reference genome. The sequencing for each sample has been done on 2 different runs (flow...cells) and 2 different lanes so for each sample I have 4 files. I am not sure when I should merge my files, before or after alignment...I read previous posts that suggest to merge the samples after alignment, but I am not sure what is the best in…

RNA-Seq alignment

updated 8.0 years ago • Matina

Hi Guys, I am trying to run cellranger count go generate count matrix for the sequenced fastq on NextSeq 500. My fastqs are named like: SRR12345671.fastq.gz SRR12345672.fastq.gz SRR12345673.fastq.gz SRR12345674.fastq.gz...SRR12345675.fastq.gz I am using following command: cellranger count --id=SRR1234567 --fastqs=/home/user/cellranger_count/fastqs --sample=SR…

10x cellranger

updated 2.9 years ago • shivangi.agarwal800

Hello everyone, I am analyzing perturb-seq data (10x). Unless cells were FACS sorted in the first hand, many of them (~40%) have not been associated to any sgRNA by cellranger. I observed that...the BFP expression of the cells with no guide associated is comparable to other cells, showing that a CRISPR guide might be present but not detected...filtered out by cellranger ? I would like to dig …

fastq perturb-seq scRNAseq

updated 2.9 years ago • paulklein05

I have data for several treatments and replicates, I'm trying to understand the sample sheet and have once question: I have fastq files L001 L002 L003 L004 But it seems that all belong to the same sample. Do...illumina instruments run each sample in 4 lanes and generate 4 fastq files for the same sample? Thanks for your time

Fasq Illumina lane

updated 5.2 years ago • ATCG

Hi. I'm new conducting analysis from illumina single-cell RNAseq fastq files. I downloaded SRR5494706 which is scRNAseq fastq file from illumina hiseq 4000. I tried to aligned...the reads with human GENCODE hg38 reference and annotation file with BWA. bwa mem -t 10 /data/genome_reference/hg38/GENCODE/GRCh38.p13.genome.fa \ /data/fastq/SRR5494706.fastq > /data...sam/SRR549…

illumina scRNA-seq

updated 3.1 years ago • Simon Ahn

Hi all, FASTQ files contain sequencing reads 'as they come off the sequencing instrument.' Is there any particular order to them in...long read fastq file for ONT and PacBio? E.g. based on the position of the flow cell? Quality? I am trying to extract certain number of reads...from both ONT and PacBio using seqtk sample something like below. ./seqtk sample -s100 pcb.fastq 10000 &…

fastq seqtk rna-seq

updated 2.7 years ago • Seong

Hello I have 400 fastq files from different samples in two sequencing runs. Both runs were on Illumina Hiseq. How i can merge the .fastq files...of both runs for each sample, and in one step..For sure we have to keep R1 and R2 separate ..I know that we can just merge the .fastq files of both runs using...cat..but i have to use this only for one sample…and than i have to repeat this many times fo…

next-gen

updated 7.5 years ago • rim.klabi

I got six fastq files (three forward and three reverse) for every sample in 96-well plate via NGS. As the first step of SNP calling, I need...convert these six files into two files (forward and reverse fastq file) for each sample. Now I am trying to write a shell scripts to automatically...merge every three forward (reverse) files into one for multiple samples. Below is the scripts I wrote to aut…

SNP sequencing

updated 6.6 years ago • zhou_1228

during seasonal algal blooms. To reanalyse the dataset, I downloaded a single multiplexed fastq file (454 pyrosequencing) from the NCBI, which contains sequences from the samples over the course of 3 years in the Eastern...English Channel. As I am demultiplexing the file into separate fastq files, I can not separate some of the samples because some samples have the identical barcode tag...for…

sequencing sequence next-gen demultiplexing

updated 5.3 years ago • m.niwano

Hi everyone, I have a tumor sample and it's matched normal fastq files. I consider my tumor sample contents to be ~99% pure. I am trying to dilute this tumor...sample to ~10% tumor content. The idea is to make a fastq file with 90% of matched normal reads and 10% of tumor sample reads. I'd like...to keep the read depth as it is, meaning if my pure tumor fastq have a mean depth of 100, after th…

matchedNormal tumor cancer fastq dilution

updated 4.9 years ago • noshadho

Hi all. I have a BAM file from one 10X scRNAseq sample. I want to try a tool out which was designed for a different type of data. The input for this tool...is the output from samtools mpileup. samtools of course detects only one sample in the bam file. I can split the BAM file into 1 file per cell using subset-bam from 10X. This will take very long and obviously...create a lot of files, but …

samtools bam scRNA

updated 24 months ago • martin.grasshoff

Are fastq sequence identifiers unique within a fastq file \ between paired-end fastq files? Does each read get its own *unique* identifier...I assume this is the case since each read corresponds to one discrete spot on the flow cell. I just want to make sure.... I'm not so sure they are unique between paired-end fastq files, however. If true, this means that two

sequencing next-gen

updated 3.5 years ago • bitjunkie

Hi! We have recently performed Chromium Next GEM single cell 3' version 3.1 (Dual Index), where we have used four different hashtag barcodes (TotalseqB) in each run (each run contains...in the panel to measure the expression of certain proteins. Now I have received 8 sets of fastq files (four from the antibody libraries and four from the cell surface protein libraries, each set containing one R…

dual demultiplexing fastq index

updated 3.3 years ago • s.sajib63

Hi i have a quick question, i have few aligned bam files from single cell RNA Seq data. I want to regenerate fastqs from them. In order to do so i am using cellranger's bamtofastq...and I am also getting fastq files but in the specified path within a folder named “MissingLibrary_1_flowcellName”. I am not sure what does this mean...any idea about this? The command I used is: cellranger bamto…

single cell cellranger single cell RNA Seq

updated 5.2 years ago • Researcher

I have over 500 paired fastq files. They have been received from a source where the Sample Identifier (S1, S2, S3) is no longer in the file names. I need to...add a Sample Identifier to my paired file names for processing using QIIME2. Here are some example file names: Tube211-16S_L001_R1_001.fastq...Tube213-16S_L001_R1_001.fastq Tube213-16S_L001_R2_001.fastq I would like to add seq…

Fastq

updated 5.7 years ago • Tawny

morning everyone, I found data from GEO, GSE115469, and the author stated that it is in a paired fastq layout. However, I have only found one fastq file. I am wondering how to handle this fastq file because I need to re-run the...cell ranger process. Thanks Andy

fastq

updated 2.3 years ago • Andy

Hi I'm trying to download data using the SRA toolkit: prefetch SRR24516563 and then I used: fastq-dump SRR24516563 -split-files The output are three different files SRR24516563_1.fastq, SRR24516563_2.fastq and...SRR24516563_3.fastq , this is from a paired end sequencing experiment (single-cell RNA seq), I'm planning to use Cell Ranger to align the reads, my question is: usuall…

fastq SRA cellranger

updated 16 months ago • charms.charms

Hi, i'm looking for upper 1TB human singe cell fastq or fastq.gz files but actually i'm noob about ncbi so it is so hard to find it. Can anybody give my links or even if how

sequencing cell single count fastq rna cellranger

updated 3.6 years ago • jys01012

Hi, I received RNA seq data for 55 samples run by illumina sequencer Nextseq500. Each sample has 4 fastq files and each file is in a separate directory. So I have...a total of 220 directories, each directory has only one fastq file. Now I need to concatenate each 4 files (belong to their respective sample) in a single fastq file. I used to use this...cat "$i"_L00*_R1_001.fastq.gz > "$i"_M…

RNA-Seq

updated 4.3 years ago • salehm

in my fastq file which is named "`8230-001-001_CTGATCGT-GCGCATAT_L004_R1.fastq.gz`" I am looking for the "`unique identifier for a...sample`". here is the 1st few lines of the file: @A00379:446:HGTTYDSX2:4:1101:1217:1094_GTGCCAAAGCAC 1:N:0:CTGATCGT+GCGCATAT ATGTGGGCAAGGAGGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGATGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTG…

fastq

updated 3.7 years ago • Sara

I am trying to process single cell data from a public dataset, containing over 6000 single-end 51 bp fastq files. Each fastq file represents a single cell...40 bp for mapping. I have used UMI-tools to extract the UMI sequence from every read in every file. Is there an efficient way to handle such a large number of files for STAR or kallisto? It feels as though this process would...be faster if …

STAR zUMIs UMI-tools

updated 6.0 years ago • volvicpellegrino

I performed 10x Chromium single cell seq and used Paired-end NovaSeq to generate a set of 8 fastq files for each sample. About filename rules: [Sample Name]_S1_L00...Lane Number]_[Read Type]_001.fastq.gz Where `Read Type` is one of: I1: Sample index read I2: Sample index read R1: Read 1 R2: Read 2 ![my fastq files for Three samples][1] Due to suboptimal r…

alignment NovaSeq bowtie fastq bwa

updated 3.0 years ago • di

one specific gene. We have 3' ends, and the sequence may or may not be different depending on the cell type we are looking at. I have the list (barcodes) from the cells we are interested in looking at, to see what the sequence is...and if its different for the different cell types. How would I find and extract this information from the fastq files? We have paired end sequencing Thanks in adv…

scRNA-seq sequencing

updated 5.5 years ago • cook.675

Hi, I would like to know the approximate fastq , BAM and VCF file size for a whole exome human sample with a 300X coverage. How can I calculate the storage based on the coverage

next-gen sequencing storage

updated 4.3 years ago • rajeefa

Hi all, I have Fastq reads something like @HWI-ST1162:73:C0KEFACXX:6:1101:1816:1918 1:N:0:CGATGT NACCCTAGAAATTATAAATCTCTTCAAGTGAGATTGTAAGGAGAAGGAGAAACTTGGTCTGGAATTTGTTATAAAAGCACTT...I aligned this fastq file with a reference genome using bowtie. How can I identify the sample name from this record? I have demultiplexed fastq...files for each sample and I also have barcode information file in …

fastq parsing

updated 13.1 years ago • deepthitheresa

Hello, I am new to bioinformatics and I would like to find out whether it is possible to download fastq files from the European Nucleotide Archive based on certain attributes for the sample. For example, what I'm trying to...accomplish is only download fastq files of the male participants of the study. I'm using enasearch but I can't seem to get it to access sample attribute data

genome sequence next-gen sequencing

updated 6.1 years ago • solyanka

enhancer SNP in lines that are heterozygotes. Are the imputed genotypes available for ENCODE cell lines? Or alternatively raw fastq files from the ENCODE ChIP-Seq, as I could use ChIP-Seq fastqs to call variants

ChIP-Seq ENCODE

updated 8.3 years ago • Milos Pjanic

Hello everyone, I am attempting to download the fastq file for GSE151671 from SRA explore. However, this dataset seems a little unusual. For the Native kidney sample, there...is only one sample, but there are two fastq files. It is not clear from the filename which one is R1 or R2. I am wondering how to distinguish

fastq

updated 2.3 years ago • Andy

Hello, I got paired end sequences with different sample number and lane number (showing one sample fastq files below) . 1) D3M0_S1_L001_R1_001.fastq.gz 2) D3M0_S45_L002_R1_001.fastq.gz

fastq cat

updated 2.7 years ago • majeedmj.ict

I have running some RNA-seqs on the illumina miseq with a control and two test groups. I have 3 samples of each group. I did one miseq chip with all 9 samples on, then did another two miseq chips with 5 samples on one then 4 on...unhappy that the data has come from different miseq runs on separate days. They want me to merge the fastq files from the different runs into one fastq files for each s…

RNA-Seq miseq illumina fastq merge

updated 6.5 years ago • william.mcentegart

I have been trying to download the fastq files of a single cell RNA experiment from [SRX8632237][1] with the following SRA runs : - SRR12108143 - SRR12108144 - SRR12108145...The runs show that it has 3 reads per spot ([link][2]). However, I am unable to download the three fastq files separately using sra-tookit (2.10.7). I always get one file. I have tried multiple combination of fasterq…

sra-toolkit 10X-Genomics NCBI single-cell

updated 3.8 years ago • pratarora

Hello, I am trying to analyze my dataset of fastq files of one sample with different sample order like Test1_S1_L001_R1_001.fastq.gz, Test1_S2_L001_R1_001.fastq.gz...and Test1_S3_L001_R1_001.fastq.gz. I am not sure about that if I should specify the sample order

count cellranger

updated 3.7 years ago • Lynn

libraries immediately after tape station results. However, my tumor samples were overrepresented pretty dramatically, with some samples having fastq files nearly 6 times larger. I’m pretty...stuck as to why this happened, as the bioanalyzer curves looked pretty consistent across my samples and I used 11 PCR cycles for the NEB kit. Specifically, my PT6 and PT5 samples had HUGE fastq file sizes…

LibraryPrep WES Human

updated 3 months ago • irate.pirate

66,121 results • Page 1 of 1323

Recent Votes

Answer: open target platform SNP to Gene qurey

Answer: Which tools do you recommend me use to get the maximum information of a protein

Answer: How do I change the title font size in ViolinPlot (Seurat)

Which tools do you recommend me use to get the maximum information of a protein?

Tools for predicting protein function?

Map genome positions onto protein coordinates?

Recent Locations • All